Detection of neuC gene for the presence of capsular polysaccharide among the clinical isolates of Escherichia coli
Sisira Padavala1, Dr. Gopinath P2
1BDS 2nd year, Saveetha Dental College, Saveetha University, Chennai.
2 Senior Lecturer, Department of Microbiology, Saveetha Dental College, Saveetha University, Chennai.
*Corresponding Author E-mail:
ABSTRACT:
Capsular polysaccharides (K antigens) are one of the main virulence factors for Escherichia coli strains to cause urinary tract infections and neonatal meningitis. There are 50 chemically different capsular K antigens found, wherein only a few are associated with infective E.coli strains. These polysaccharides associated with disease that encodeK1 antigen (polysialic acid) are involved in causing a wide variety of infections such as septicemia, urinary tract infections, and meningitis. A total of 20 clinical isolates of E. coli were screened for the presence of neuC gene by PCR. We have observed 15% positivity among our isolates. This indicates that, the pathogenicity of urinary tract infections by these pathogens might be crucially played by this gene encoding K capsular polysaccharide.
KEYWORDS: Escherichia coli, neuC gene, K1 antigen, PCR
INTRODUCTION:
Escherichia coli is a normal inhabitant of the gut micro flora. Some of the strains of E. coli cause severe human infections and many strains of E. coli are known to produce extracellular polysaccharide capsules [1]. Capsular polysaccharides (K antigens) are one of the main virulence factors for E. coli strains to cause urinary tract infections and neonatal meningitis [2]. There are 50 chemically different capsular K antigens found, wherein only a few are associated with infective E.coli strains. These polysaccharides associated with disease that encodeK1 antigen (polysialic acid) are involved in causing a wide variety of infections such as septicemia, urinary tract infections, and meningitis [3].The K1 antigen is one of the specific types of surface polysaccharides found among E. coli strains. There has been a vast difference in structural variability among E. coli capsules and at least 80 different K antigens are identified so far.
Only a few of these capsular structures have been implicated in pathogenesis of E. coli infections[1].The pathogenicity of E. coli strains is directly correlated with the presence of numerous virulence factors[4]. The virulence of E. coli K1+ is related to the ability of the K1 capsule to inhibit phagocytosis and to resist antibody-independent serum bactericidal activity and the ability of K1+ strains to cross the blood–brain barrier (BBB)
Capsules protect bacteria against the host immune system. The α-2,8-linked neuAc polysaccharides of E.coli Kl and Neisseriameningitidis group B resemble host glycoconjugates such as cell adhesion protein N-CAM[5]. The proteins necessary for synthesis, activation, and polymerization of neuAc are encoded by the 17-kbkps gene cluster of E.coli K1[6]. Silver et al have demonstrated that cells harboring mutations in neuC become sensitive to capsular polysaccharide specific phage only when supplied with exogenous sialicacid, suggesting involvement of the neuC gene product in neuAc biosynthesis [7]. With this background, we have taken this study to detect the gene responsible for expression of K1 polysaccharide in E. coli isolates.
MATERIALS AND METHODS:
Bacterial isolates:
A total of 20 non repetitive urinary isolates of Escherichia coli were collected from Saveetha Medical College and Hospitals, Chennai. They were processed for a battery of standard biochemical tests and confirmed. Isolates were preserved in semisolid trypticase soy broth stock and were stored at 4 ºC until further use.
Antibiotic susceptibility testing:
Antibiotic susceptibility test was determined for these isolates to routinely used antibiotics such as ampicillin, amoxicillin, amikacin, norfloxacin, ceftazimide, cefotaxime, ciprofloxacin and gentamicin, imipenem as by Kirby Bauer disc diffusion method [8].
Detection of neuCgene in E.coli:
Escherichia coli isolates were detected for the presence of neuC gene by PCR analysis. Detection of the gene was carried out using primer as depicted in table 1. Bacterial DNA was extracted by boiling lysis method. 1 µL of DNA extract was used as template for PCR reaction. The reaction mixture contained 1mM of Mgcl20.2mM dNTP mix and 0.8µM of neuC gene with 0.5U of Taq polymerase (New England Bio labs) in a 1x PCR buffered reaction. A positive control of E.coli with neuC gene was also included in this study. PCR amplification was carried out using thermal cycler (Eppendorf) with the following cycling condition. Initial denaturation at 96oC for 5 min and 30 cycles for 30s, 68oC for 30s and 68o C for 60s, followed by a final extension of 5 min at 74oC. PCR products were resolved in 1.5% agarose gel. A 100bp ladder was including in all the gel analysis [10].
Table 1: Gene sequencing of neuC gene
|
Primer |
Primer sequence |
Product size |
|
neuC |
AGGTGAAAAGCCTGGTAGTGTG GGTGGTACATCCCGGGATGTC |
676 bp |
RESULTS:
Sample wise distribution of clinical isolates of E.coli:
Of the 20 clinical isolates of E.coli, 12/20 (60%) were from acute urinary tract infections and 8/20 (40%) were from chronic urinary tract infections. Figure 1 depicts the sample wise distribution of clinical isolates of E.coli.
Figure 1: Sample wise distribution of urinary isolates of E.coli
Antibiotic susceptibility testing:
In our isolates, we have found increased percentage 14/20 (70%) of isolates showed sensitivity to amikacin followed by gentamicin, which showed sensitivity of 9/20 (45%). 80- 90% of E.coli isolates showed resistance to cephalosporin group of drugs. 6/20 (30%) were found to be resistant to imipenem. However, we have observed an elevated level of resistance to other routinely used antibiotics. The detailed resistant pattern of E.coli isolates is shown in table 2.
Table 2: Showing antibiotic sensitivity pattern of E.coli
|
Antibiotics |
Sensitivity (20) (%) |
Intermediate (20) (%) |
Resistant(20) (%) |
|
Ampicillin |
5 |
0 |
95 |
|
Amoxicillin |
5 |
0 |
95 |
|
Ceftazidime |
10 |
10 |
80 |
|
Cefotaxime |
5 |
5 |
90 |
|
Amikacin |
70 |
10 |
20 |
|
Gentamicin |
45 |
20 |
35 |
|
Norfloxacin |
15 |
15 |
70 |
|
Ciprofloxacin |
20 |
5 |
75 |
|
Imipenem |
70 |
0 |
30 |
Result of neuC gene in E.coli:
3/20 (15%) clinical isolate of urinary isolates of E.coli was found to harbour neuC gene.
Figure 2: Representative gel picture showing positive for neuC gene
DISCUSSION:
In our study we have observed 15% of our E. coli isolates from patients affected with urinary tract infections showed positive for neuC gene. This gene codes for capsular polysaccharide K antigen. This K antigen is known to regulate several functions in our system among which resistance to phagocytosis is one of the main virulence function exhibited by this trait. Van Dijk et al showed that many of E. coli strains isolated from blood cultures positive patients with E. coli bacteremia possessed K antigen and were poorly phagocytized[9]. This inhibition of phagocytosis seems to be related to an impaired recognition of the K+ strains by the phagocytes due to ineffective opsonization than resistance to intracellular killing. In contrast, we have used only isolates from acute and chronic UTI. This might play a role in showing different results by this gene than isolates from blood samples. Similar kind of study done by Kaczmarek et al in 2012 using capsular and non capsular strains of E. coli, they have reported 37.3% of positivity. But in our study we found great positiveness in showing this gene amplicons[10].
CONCLUSION:
From our study, it is very clear that capsular polysaccharide is one of the main component in resisting the host immune response. The pathogenicity of urinary tract infections by these pathogens might be crucially played by this gene encoding K capsular polysaccharide. This is a basic and preliminary study. To rule out the relationship between presence of K capsular polysaccharide and urinary tract infections by E. coli, more number of samples and patients from different regions having UTI have to to be included.
ACKNOWLEDGMENT:
We thank Dr. Kalyani, Professor and Head of the Department of Microbiology, Saveetha Medical College, Chennai for kindly providing the clinical isolates to carry out our research work fruitfully.
REFERENCES:
1. Whitfield C and IS Roberts. Structure, assembly, and regulation of expression of capsules in E. coli. Mol. Microbiol. 31;1999: 1307–1319.
2. KaiJser B, Hanson LA, Jodal V, Lindin-Janson G and Robbins JB. Frequency of E.coli K antigens in urinary-tract infections in children .Lanceti.1977:664-666.
3. Silver RP and Vimr ER. Polysialic acid capsule of E. coli K1 in the bacteria. Molecular basis of bacterial pathogenesis. Academic Press, Inc., New York, N.Y.11;1990: 39-60.
4. Watt S, Lanotte P, Mereghetti, L, Moulin-Schouleur M, Picard B & Quentin R. Escherichia coli strains from pregnant women and neonates: intraspecies genetic distribution and prevalence of virulence factors. J Clin Microbiol 41; 2003:1929–1935.
5. Hoffman S, Sorkin BC, White PC, Brackenbury R, Mailhammer R, Rutishauser U, Cunningham BA and Edelman GM. Chemical characterization of a neural cell adhesion molecule purified from embryonic brain membrane. J Biol Chem 257; 1982:7720-7729.
6. Echarti CB, Hirschel GJ, Boulnois JM, Varly F, Waldvogel, and Timmis KN. Cloning and analysis of the K1 capsule biosynthesis genes of Escherichia coli: lack of sequences for homology with Neisseria meningitidis group BDNA sequences. Infect Immun 41; 1983:54-60.
7. Silver RP, Vann WF and Aaronson W. Genetic and molecular analyses of Escherichia coli K1 antigen genes. J Bacteriol 157; 1984:568-575.
8. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Disk Tests; Approved Standards; Doucement M2-A9, 9th ed., Vol 26. Wayne, PA: CLSI; 2015
9. Van Dijk WC, Verbrugh HA, Peters R, van derTol ME et al. Escherichia coli K antigen in relation to serum induced lysis and phagocytosis. J Med Microbiol 12; 1979:123-130.
10. Kaczmarek A, Budzynska A, Gospodarek E. Prevalence of genes encoding virulence factors among Escherichia coli with K1 antigen and non-K1 E. coli strains. Journal of Medical Microbiology 61; 2012:1360–1365.
Received on 24.06.2016 Modified on 15.07.2016
Accepted on 20.07.2016 © RJPT All right reserved
Research J. Pharm. and Tech 2016; 9(9):1454-1456.
DOI: 10.5958/0974-360X.2016.00281.X